90
|
Miraibio Inc
dnasis max version 2.0 Dnasis Max Version 2.0, supplied by Miraibio Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dnasis+pro+software+v2%2E0/pmc02323570-125-12-16?v=Miraibio+Inc Average 90 stars, based on 1 article reviews
dnasis max version 2.0 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
94
|
Addgene inc
nickase plasmid pspcas9n bb 2a puro Nickase Plasmid Pspcas9n Bb 2a Puro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dnasis+pro+software+v2%2E0/pmc06451320-201-5-10?v=Addgene+inc Average 94 stars, based on 1 article reviews
nickase plasmid pspcas9n bb 2a puro - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
90
|
GeneWorks
geneworks v. 2.5.1 Geneworks V. 2.5.1, supplied by GeneWorks, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dnasis+pro+software+v2%2E0/pm10564787-46-13-16?v=GeneWorks Average 90 stars, based on 1 article reviews
geneworks v. 2.5.1 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
96
|
Addgene inc
cas9 nickase expression vector pspcas9 bb 2a puro px459  Cas9 Nickase Expression Vector Pspcas9 Bb 2a Puro Px459, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dnasis+pro+software+v2%2E0/pmc08693470-322-18-27?v=Addgene+inc Average 96 stars, based on 1 article reviews
cas9 nickase expression vector pspcas9 bb 2a puro px459 - by Bioz Stars,
2026-07
96/100 stars
|
Buy from Supplier |
90
|
Helixx Technologies Inc
dnasis program version 2.0 Dnasis Program Version 2.0, supplied by Helixx Technologies Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dnasis+pro+software+v2%2E0/pm12619818-73-8-12?v=Helixx+Technologies+Inc Average 90 stars, based on 1 article reviews
dnasis program version 2.0 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: iScience
Article Title: Emergence and patterning dynamics of mouse-definitive endoderm
doi: 10.1016/j.isci.2021.103556
Figure Lengend Snippet:
Article Snippet: A single-guide RNA (sgRNA) recognizing a sequence near the stop codon of SOX17 ('GCAACTACCCCGACATTTGA') was cloned into a
Techniques: Recombinant, Knock-Out, Transfection, Plasmid Preparation, Software